Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.

Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.
3′ TACTAGCCACATCTACCGATC 5′ Template strand used for transcription

5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)

An electron micrograph shows a structure with a rigid outer wall, a membrane, ribosomes, a nonmembrane bound nuclear area, and no endoplasmic reticulum or mitochondria. Explain why the structure is or is not each of the following: a human T cell, a virus, a bacterial cell, a yeast cell.
Describe the difference between an emerging and a re-emerging disease and give a recent example of a viral or a bacterial infection of each and explain the reason for that classification.
Name the four types of acquired immunity and describe the mechanisms by which a person acquires the immunity (“how it is conferred”). In a table describe the following characteristics for each them: type of immunizing agent (antibodies or antigen), relative time for immunity to appear, relative time the immunity lasts, and the source of antibodies (for example, self or non-self) that act against a pathogen or other antigen

Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Benefits of our college essay writing service

  • 80+ disciplines

    Buy an essay in any subject you find difficult—we’ll have a specialist in it ready

  • 4-hour deadlines

    Ask for help with your most urgent short tasks—we can complete them in 4 hours!

  • Free revision

    Get your paper revised for free if it doesn’t meet your instructions.

  • 24/7 support

    Contact us anytime if you need help with your essay

  • Custom formatting

    APA, MLA, Chicago—we can use any formatting style you need.

  • Plagiarism check

    Get a paper that’s fully original and checked for plagiarism

What the numbers say?

  • 527
    writers active
  • 9.5 out of 10
    current average quality score
  • 98.40%
    of orders delivered on time
error: